| HOME | HELP | CONTACT US | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Okazaki Institute for Integrative Bioscience, National Institutes of Natural Sciences, 5-1 Higashiyama, Okazaki, Aichi 444-8787, Japan
1 National Institute for Environmental Studies, 16-2 Onogawa, Tsukuba City, Ibaraki 305-8506, Japan
(Requests for offprints should be addressed to H Watanabe; Email: watanabe{at}nibb.ac.jp)
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Molecular target of Ec is known as an ecdysone receptor (EcR), which belongs to the nuclear receptor family. EcR is a ligand-dependent transcription factor and it activates transcription of target genes by forming a heterodimer with another nuclear receptor, the ultraspiracle (USP) protein. This heterodimer formation is essential for gene activation in Drosophila and other arthropods (Yao et al. 1992, 1993, Hall & Thummel 1998).
As in the case in other arthropods, Ec and JH play important roles in cladocerans (Baldwin et al. 2001, Mu & LeBlanc 2002). The Ec affects male progeny production and chemicals related to JH increase male production in Daphnia magna and other daphnids (Peterson et al. 2001, Tatarazako et al. 2003, Oda et al. 2005). These findings suggest that sex determination in Daphnia is closely tied to hormonal systems. Thus, the investigation of hormonal systems in Daphnia will improve our understanding of reproduction, development, and growth. Therefore, it is important to clarify the genetic structure and expression profile of EcR in Daphnia for understanding the hormonal effect on Daphnia.
Understanding of EcR and USP of Daphnia is also important from the ecotoxicological point of view. Small crustaceans such as water fleas play important roles in ecosystems, providing an essential component of fish diets and contributing to water clarity by grazing algae. In light of the importance of small crustaceans to the ecosystem, there has been a considerable effort to evaluate the ecotoxicity of various chemicals on daphnids and to quantify their effects on growth, reproduction, and behavior. In contrast, our understanding of Daphnia hormonal system at the molecular level remains limited.
Understanding of EcR and USP may also be important for the development of insecticides. Some insecticides have been developed to target the growth of pests by disturbing hormonal systems (Dhadialla et al. 1998); however, their effects on non-target arthropods have not been evaluated fully. In order to develop insecticides that are safe for the environment, it would be desirable to have molecular discrimination between the hormone receptors of pests and non-target arthropods. Cloning of hormone receptors and development of reporter systems may be helpful in understanding the similarities and differences between Daphnia and other arthropods.
In this study, we cloned cDNAs encoding EcR and USP from Daphnia. We identified EcR subtypes and showed that these subtypes are differentially regulated. In addition, using a reporter system, we analyzed their responses to several chemicals.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Ponasterone A, Muristerone A, Tebufenozide, Pyriproxyfen, and Fenoxycarb were purchased from Wako Pure Chemical Industries Ltd, Osaka, Japan. JH and 20-hydroxy Ec were purchased from ICN (Costa Mesa, CA, USA). All chemicals were dissolved in ethanol.
Daphnia strain and culture conditions
The D. magna strain (NIES clone) was obtained from the National Institute for Environmental Studies (NIES; Tsukuba, Japan; Tatarazako et al. 2003). The strain originated at the Environmental Protection Agency USA and was maintained for more than 10 years at NIES. Culture medium was prepared using charcoal-filtered tap water maintained at room temperature overnight prior to use. Cultures of 20 individuals per liter were incubated at 24 ± 1 °C under a 14 h light:10 h darkness photoperiod.A0.01 mlsuspensionof 4.3 x 108 cells/mlChlorella was added daily to each culture. Water quality (pH and dissolved oxygen concentration) was measured every 2 days by the Environmental Research Center KK (Tsukuba, Japan). Water hardness was between 72 and 83 mg/l, pH between 7.0 and 7.5, and dissolved oxygen concentrations between 80 and 99%.
Cloning of EcR and USP
A Daphnia cDNA library (Watanabe et al. 2005) was screened with digoxigenin-labeled DNA probes of Drosophila EcR or USP (Dr S Kato, Tokyo University, Japan) and partial cDNA clones were obtained. The cDNAs encoding full-length EcR B1 and USP of Drosophila were excised from the expression vectors of the genes (Maki et al. 2004). The excised DNA fragments were labeled with digoxigenin-11 dUTP using DIG Labeling Kit (Roche Diagnostics). Daphnia cDNA libraries were screened with the DIG-labeled probes. Hybridization was performed using DIG Easy Hyb (Roche Diagnostics) and detected by DIG Nucleic Acid Detection Kit (Roche Diagnostics). From 2 x 106 independent clones, 10 and 14 clones were isolated as EcR and USP cDNA respectively. Based on the sequences of the cDNAs, we performed 5' rapid amplification of cDNA ends (RACE; Cap Fishing, SeeGene, Seoul, South Korea), followed by PCR. These products were purified by agarose gel electrophoresis, cloned into pGEM-T easy (Promega), and sequenced using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems Japan Ltd, Tokyo, Japan). The presence of specific mRNAs was confirmed using PCR with oligonucleotides containing the translational start and stop codons. These nucleotide sequences were submitted to the DNA Data Bank of Japan (DDBJ) web site (Accession number: AB274819 [GenBank] -24).
Ligand-binding domain (LBD) amino acid sequences were aligned and analyzed using CLUSTAL W from the DDBJ web site (http://www.ddbj.nig.ac.jp/search/clustalw-j.html; Thompson et al. 1994), to construct a phylogenetic tree using the neighbor-joining method (Saitou & Nei 1987). The CLUSTAL W analysis was performed using default settings and relative branch support was evaluated by bootstrap analysis.
Quantitative PCR
For gene expression analysis, Daphnia at 2 weeks of age were used. The time of molting was assigned as 0 h and samples were collected every 6 h for the following 72 h. In general, the next molting was observed at 66 h. For embryos, the time of ovulation was assigned as 0 h. The embryos were collected every 6 h for the following 72 h. After collection, Daphnia were washed briefly, and then treated with TRIZOL (Invitrogen Corp.) to extract total RNA, according to the manufacturer’s protocol. Homogenization was performed using the NS-310E physcotron (Nichion, Tokyo, Japan), after which cDNA was synthesized from total RNA using Superscript II RT (–; Invitrogen Corp.) with random primers at 42 °C for 60 min. The PCR were performed in an ABI Prism 7000 (Applied Biosystems Japan Ltd) using the SYBR-Green PCR core reagents kit (Applied Biosystems Japan Ltd), in the presence of appropriate primers. PCR amplifications were performed in triplicate using the following conditions: 2 min at 50 °C and 10 min at 95 °C, followed by a total of 40 two-temperature cycles (15 s at 95 °C and 1 min at 60 °C). In order to avoid the unexpected degradation of RNA, we did not treat RNA with DNase. Instead, we confirmed that contamination of genomic DNA was negligible by PCR using intron containing primers (data not shown). Gel electrophoresis and melting curve analyses were performed to confirm correct amplicon size and the absence of non-specific bands. The primers were chosen to amplify short PCR products of < 150 bp; primer sequences are listed in Table 1
.
|
We used a two-hybrid system to detect chemicals that activate Daphnia EcR. DNA encoding the LBDs of EcR and USP were amplified using the following oligonucleotides: Daphnia EcR, Forward (F) 5'- GGATCCTCAC-GGTCGGCATGCGGCC -3' and Reverse (R) 5'-TTCTAGATGGCGTTCACGAATGGAC–3'; Daphnia USP, F 5'- AGGATCCTGCAGATGGGCATGAAGCG–3' and R 5'- TTCTAGACCAGTTCTAAGTTTCTGC–3'. The amplified DNA fragments were digested with BamHI and XbaI and cloned into pBIND and pACT (Promega) respectively. They were designated as pBIND-EcR (LBD) and pACT-USP (LBD) respectively. As a control, we also constructed Drosophila EcR/USP two-hybrid system. The -corresponding Drosophila domains were amplified using the following oligonucleotides: Drosophila EcR, F 5'- GG ATCCTCACGGTCGGCATGCGGCC -3' and R 5'-GCTCTAGACTATGCAGTCGTCGAGTGCTCC -3'; and Drosophila USP, F 5'- GTCGACTAACCTGCGGCAT GAAGCG-3' and R 5'- TCTAGACTACTCCAGTTTCAT CGCC-3'. The amplified DNA fragments were digested with SalI and XbaI and cloned into pBIND and pACT (Promega) respectively. The cDNA encoding the LxxLL domain of Drosophila Taiman protein (1028–1235 amino acid (aa)) was amplified using total RNA prepared from Schneider cells and the primers 5'-GGATCCGTGGCGGTCTGGG AGGACTG-3' and 5'- TCTAGATCAGGCTAGCGTGCT GCTCAC-3'. The amplified DNA fragment was cloned into pGEM-T easy, digested with BamHI and NotI, then subcloned into pACT using the BamHI and NotI sites. This construct was designated as pact-taiman (LXXLL). All of the inserted sequences were confirmed as being cloned in-frame without any amino acid substitutions or deletions.
For transfections, Chinese hamster ovary (CHO) cells were grown in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum and incubated at 37 °C in a 5% CO2 atmosphere. The day before transfection, cells were transferred to a 24-well plate. The transfection was performed using FuGENE6 (Roche Diagnostics), according to the manufacturer’s protocols. Each well received 0.03 µg pBIND-EcR (LBD), 0.03 µg pACT-USP (LBD), 0.1 µg pACT-taiman (LXXLL), and 0.3 µg pG5luc, which has luciferase gene under the control of GAL4-binding site. Ligand was added to the medium after 24 h and cells were harvested after 48 h. Reporter activities were measured using the Dual-Luciferase Assay kit (Promega), according to the manufacturer’s protocols. The experiment was repeated thrice and the average values were calculated.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
By screening the Daphnia cDNA library (Watanabe et al. 2005) and combination of 5' RACE, five types of full-length cDNAs were obtained as schematically indicated in Fig. 1. The deduced amino acid sequences indicated that all five cDNAs encoded identical 39 aa at the C-terminus of the A/B domain, 73 aa of C domain, 102 aa of D domain, and 221 aa of E/F domain (Fig. 2). The five cDNAs differ in most part of A/B domain and 5' untranslated region (UTR). According to their coding sequences, there were three types of A/B domain. Two of them have identical amino acid sequence except for N-terminal region. The shorter subtype (597 aa) lacks 124 aa at the N-terminus of the longer subtype (721 aa). These two subtypes have two common types of UTRsas indicated in Figs 1 and 3. As BLAST searches indicated similarity between the common amino acid sequence of the two subtypes and those of EcR-A of other species, these two proteins were designated as A1 (597 aa) and A2 (721 aa) subtypes. Characteristic amino acids conserved in the A box of many species could be identified in the two subtypes (Cruz et al. 2006).
|
|
|
. The 629 aa subtype showed similarity to EcR-B from other species and EcR-B subtype-specific amino acids were conserved in the Daphnia EcR as shown in Fig. 5. Thus, this subtype was designated as EcR-B.
|
|
(Table 2).
|
) were obtained from database (National Center for Biotechnology Information: http://www.ncbi.nlm.nih.gov/) and analyzed. Daphnia EcR showed highest similarity to the fiddler crab Uca (Chung et al. 1998). As indicated by previous study of the fiddler crab, LBD of this group showed similarity to LBD of human LXR (Fig. 6).
|
|
By screening the Daphnia cDNA library (Watanabe et al. 2005) with the Drosophila USP probe, we isolated clones exhibiting a high degree of sequence similarity to genes encoding other USPs and retinoid x receptors (RXRs). Using the clone sequences, we performed 5' RACE to obtain full-length USP cDNA and obtained two DNA fragments. The deduced amino acid sequences of these fragments were identical and the only differences observed were in the 5' flanking sequences and the amino acid sequence was identical to the previous study (Wang et al. 2007; Supplemental Figure; see supplementary data in the online version of the Journal of Endocrinology at http://joe.endocrinology-journals.org/content/vol193/issue1).
USP comprises A/B, C, D, and E/F domains (81, 66, 31, and 222 aa respectively), and as with other nuclear receptors, the DNA-binding domain exhibits a high level of conservation with other USP/RXRs (Table 2
). We also obtained a variant containing a 6 aa deletion in the A/B domain (deleted between amino acids 49 and 54). Different from the fiddler crab that showed highest similarity to Daphnia EcR, deletion variant of LBD could not be isolated in this study. The LBD phylogenic tree indicates a similarity between Daphnia USP and USPs in other crustaceans, as well as insects. A dendrogram calculated from alignments of these LBDs is presented in Fig. 7, although the DBD of Daphnia USP shows a greater similarity to that of Drosophila USP than to human RXR, the LBD shows a greater similarity to the latter than to the former. Overall, these data indicate that Daphnia EcR is most similar to EcRs from other crustaceans and that Daphnia USP is most similar to mammalian RXRs, rather than to USPs from insects such as the Diptera or Lepidoptera.
|
The fact that there were five types of mRNA coding EcR raised a possibility that expression of EcR subtypes are differentially regulated in a spatio-temporal manner. Thus, we examined expression of the different EcR subtypes between molts in adulthood ( > 2 weeks old). We designed primers to discriminate between expression of EcR-A and EcR-B (Table 1), and observed differences in their temporal expression (Fig. 8). Changes in mRNA expression levels of these subtypes were different from each other. During the molting period, gene expression changes of EcR-B were prominent. Gene expression levels of EcR-B were activated more than 20-fold just before molting, whereas EcR-A was activated only fivefold. Similar to EcR-A, gene expression changes of USP were not drastically changed but it was notable that temporal gene expression profile of USP was similar to that of EcR-A. Both USP and EcR-A were activated around 60 h, which is 6 h before molting. Although clarification of tissue-specific expression patterns of these subtypes is necessary, this result suggests that EcR-A and EcR-B play a distinct role in molting.
|
Response to Ecs and construction of a reporter system
In order to confirm the response of EcR to Ec and related chemicals, we constructed a two-hybrid system as a reporter for ligand-dependent transcription alactivation of EcR from Daphnia and Drosophila. For both organisms, we prepared fusions of DNA encoding the LBD of EcR and the DBD of Gal4, as well as the LBD of USP and the transcriptional activation domain of VP16. When these chimeric genes were transfected into CHO cells, ligand-dependent transcriptional activation could be detected. This activation was enhanced further by cotransfection of DNA encoding the Drosophila Taiman LxxLL motif (Bai et al. 2000), a known coactivator of EcR in Drosophila. The enhancement of the reporter gene was evident when it was transfected with Drosophila EcR and USP (data not shown).
Ligand-dependent transcriptional activation was observed for both Daphnia and Drosophila EcR reporters only when Ec analogs such as Ponasterone A, Muristerone A, and Tebufenozide were added to the culture medium (Fig. 10). Non-ecdysteroidal chemicals such as JH, Pyriproxyfen, and Fenoxycarb did not activate the reporter. These results suggest that the recombinant EcR and USP can interact in a ligand-dependent manner that is specific to Ec.
|
). In contrast, Daphnia EcR/USP responded to lower doses of Ponasterone A than Drosophila EcR/USP (Fig. 11). Interestingly, the effects of Tebufenozide were different to Ponasterone A with Drosophila EcR/USP exhibiting higher expression levels than Daphnia EcR/USP at equivalent dosages. Given that these responded similarly to Ec, the different responses to Ponasterone A and Tebufeno-zide may reflect differences in ligand specificity.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In this study, we cloned and characterized EcR and USP from D. magna. We found three isoforms of EcR: two subtypes exhibited similarity to Drosophila EcR-A and the third showed similarity to Drosophila EcR-B. This is the first report showing A/B isoforms in crustceans. The presence of multiple EcR subtypes has been observed for other species. Three subtypes are also found in Drosophila: one EcR-A isoform and two EcR-B isoforms (EcR-B1 and the truncated form EcR-B2; Talbot et al. 1993). Characteristic tissue and temporal expression patterns of these isoforms have been reported in Drosophila and other arthropods such as silk worms (Kamimura et al. 1997) and tobacco hornworms (Jindra et al. 1996). These isoforms share common DNA and LBDs, but differ in their N-terminal A/B domains.
We examined temporal changes in the expression of these EcR subtypes, although differences in tissue distribution remain to be determined. Our observation of differential isoform expression in Daphnia suggests that, as with other species, these subtypes play distinct roles in daphnids. As the changes in EcR-B expression corresponded closely to molting, this isoform may be responsible for the initiation of this process. Although it was difficult to precisely estimate the copy number of mRNA of each subtype, mRNAs of EcR-A and USP could be easily detected by PCR rather than EcR-B in adult. As EcR functions by forming heterodimer with USP, major EcR heterodimer may be composed of EcR-A and USP and this component may be changed to EcR-B and USP at critical stages such as molting and early development. Precise spatio-temporal analyses may elucidate the role of other EcR subtypes and indicate how their functional differences affect hormonal systems in Daphnia.
At the beginning of embryogenesis, transcription status changes drastically and it is difficult to normalize using genes that are stably expressed. Thus, in this study, we showed gene expression changes based on the number of embryos in Fig. 9. Although we examined gene expression changes of several ribosomal proteins and elongation factors that have been used for the control gene, we indicated only the expression change of ribosomal protein L32 in Fig. 9, because gene expression changes were minimum. It was notable that the changes of total RNA, ribosomal protein L32, and USP were less than ninefold, expression levels of EcR-A and EcR-B were changed more than 30- and 140-fold respectively. Thus, the characteristic changes of EcR expression are not essentially affected by normalization.
|
In order to confirm that recombinant Daphnia EcR could respond to Ec, we expressed these receptors in cell culture and examined their responses. Certain combinations of EcR and USP cannot efficiently activate ligand-dependent transcription in cell culture. When we transfected DNA encoding the full-length receptors fused to reporter genes, weak activation (less than twofold) was detected. However, activation could not be detected in the absence of USP. In order to enhance ligand-dependent activation, we constructed a two-hybrid system for the detection of ligand-dependent protein–protein interactions. Although the doses required for the detection of gene activation were high (µM concentrations), even for Ec, they were consistent with previously reported dosages (Hu et al. 2003).
We cotransfected DNA encoding the Drosophila Taiman LxxLL motif with our EcR/USP reporter system. In the absence of Tai (LxxLL) expression, transcriptional activation of Drosophila EcR/USP could not be detected, although DaphEcR/USP responded to Ec and other Ec analogs (data not shown). Although the molecular interactions of these chimeric genes remain unclear, it has been suggested that Drosophila USP exerts an allosteric effect on EcR (Hu et al. 2003) and our study indicates that binding of the Taiman LxxLL motif may contribute to EcR conformational stability.
Daphnia EcR response to chemicals
Using our reporter system, we were able to compare the effects of Ec and other chemicals on EcR/USP activity in Daphnia and Drosophila. We found that Daphnia and Drosophila responded similarly to Ec, but exhibited different responses to Ponasterone A and Tebufenozide. Ponasterone A activated Daphnia EcR/USP at a lower concentration than that required to activate Drosophila EcR/USP. In addition, Ponasterone A is known to cause molting in D. magna at a 10-fold lower concentration than Ec. These results support the suggestion that differences in the affinity of EcR for its ligands are responsible for the different concentrations of EC and Ponasterone A required to affect molting (Baldwin et al. 2001). Recently, the structure of Heliothis virescens EcR/USP was elucidated using X-ray crystallography, and investigation of Ponasterone A and BYI06830 (a non-steroidal, lepidopteran-specific agonist) binding indicated the presence of different ligand-binding pockets for steroidal and non-steroidal ligands (Billas et al. 2003). Thus, a possible reason for differences in ligand-binding activity may be differences in the amino acids responsible for non-steroidal ligand binding. As the amino acids responsible for binding BYI06830 in Heliothis virescens are conserved in Daphnia, the ligand-binding activity of Daphnia EcR cannot be explained completely by the composition of amino acid residues responsible for direct ligand binding.
In this study, we cloned EcR and USP from Daphnia magna and confirmed that these nuclear receptors interact in a ligand-dependent manner. As interest in the development of environmentally safe insecticides increases, we consider that the in vitro reporter system developed in this study may be useful not only for understanding the role of hormones at the molecular level in Daphnia, but also for the screening and evaluation of Ec-like chemicals for the purposes of pest control.
|
Acknowledgements |
|---|
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Baldwin WS, Bailey R, Long KE & Klaine S 2001 Incomplete ecdysis is an indicator of ecdysteroid exposure in Daphnia magna. Environmental Toxicology and Chemistry 20 1564–1569.[CrossRef][ISI][Medline]
Billas IM, Iwema T, Garnier JM, Mitschler A, Rochel N & Moras D 2003 Structural adaptability in the ligand-binding pocket of the ecdysone hormone receptor. Nature 426 91–96.[CrossRef][Medline]
Chung AC, Durica DS, Clifton SW, Roe BA & Hopkins PM 1998 Cloning of crustacean ecdysteroid receptor and retinoid-X receptor gene homologs and elevation of retinoid-X receptor mRNA by retinoic acid. Molecular and Cellular Endocrinology 139 209–227.[CrossRef][ISI][Medline]
Cruz J, Mane-Padros D, Belles X & Martin D 2006 Functions of the ecdysone receptor isoform-A in the hemimetabolous insect Blattella germanica revealed by systemic RNAi in vivo. Developmental Biology 297 158–171.[CrossRef][ISI][Medline]
Dhadialla TS, Carlson GR & Le DP 1998 New insecticides with ecdysteroidal and juvenile hormone activity. Annual Review of Entomology 43 545–569.[CrossRef][ISI][Medline]
Dubrovsky EB 2005 Hormonal cross talk in insect development. Trends in Endocrinology and Metabolism 16 6–11.[CrossRef][ISI][Medline]
Hall BL & Thummel CS 1998 The RXR homolog ultraspiracle is an essential component of the Drosophila ecdysone receptor. Development 125 4709–4717.[Abstract]
Hu X, Cherbas L & Cherbas P 2003 Transcription activation by the ecdysone receptor (EcR/USP): identification of activation functions. Molecular Endocrinology 17 716–731.
Jindra M, Malone F, Hiruma K & Riddiford LM 1996 Developmental profiles and ecdysteroid regulation of the mRNAs for two ecdysone receptor isoforms in the epidermis and wings of the tobacco hornworm, Manduca sexta. Developmental Biology 180 258–272.[CrossRef][ISI][Medline]
Kamimura M, Tomita S, Kiuchi M & Fujiwara H 1997 Tissue-specific and stage-specific expression of two silkworm ecdysone receptor isoforms –ecdysteroid-dependent transcription in cultured anterior silk glands. European Journal of Biochemistry 248 786–793.[ISI][Medline]
Maki A, Sawatsubashi S, Ito S, Shirode Y, Suzuki E, Zhao Y, Yamagata K, Kouzmenko A, Takeyama K & Kato S 2004 Juvenile hormones antagonize ecdysone actions through co-repressor recruitment to EcR/USP heterodimers. Biochemical and Biophysical Research Communications 320 262–267.[CrossRef][ISI][Medline]
Mu X & LeBlanc GA 2002 Environmental antiecdysteroids alter embryo development in the crustacean Daphnia magna. Journal of Experimental Zoology 292 287–292.[CrossRef][ISI][Medline]
Mu X & LeBlanc GA 2004 Cross communication between signaling pathways: juvenoid hormones modulate ecdysteroid activity in a crustacean. Journal of Experimental Zoology. Part A, Comparative Experimental Biology 301 793–801.
Oda S, Tatarazako N, Watanabe H, Morita M & Iguchi T 2005 Production of male neonates in four cladoceran species exposed to a juvenile hormone analog, fenoxycarb. Chemosphere 60 74–78.[Medline]
Peterson JK, Kashian DR & Dodson SI 2001 Methoprene and 20-OH-ecdysone affect male production in Daphnia pulex. Environmental Toxicology and Chemistry 20 582–588.[CrossRef][ISI][Medline]
Riddiford LM 1993 Hormones and Drosophila development. In The Development of Drosophila Melanogaster, pp 899–939. Eds N Bate & A Martinez-Arias. New York: Cold Spring Harbor Laboratory Press.
Saitou N & Nei M 1987 The neighbor-joining method: a new method for reconstructingphylogenetic trees.Molecular Biologyand Evolution 4 406–425.
Sekimoto T, Iwami M & Sakurai S 2006 Coordinate responses of transcription factors to ecdysone during programmed cell death in the anterior silk gland of the silkworm, Bombyx mori. Insect Molecular Biology 15 281–292.[CrossRef][ISI][Medline]
Subramoniam T 2000 Crustacean ecdysteriods in reproduction and embryogenesis. Comparative Biochemistry and Physiology. Toxicology and Pharmacology 125 135–156.[CrossRef]
Talbot WS, Swyryd EA & Hogness DS 1993 Drosophila tissues with different metamorphic responses to ecdysone express different ecdysone receptor isoforms. Cell 73 1323–1337.[CrossRef][ISI][Medline]
Tatarazako N, Oda S, Watanabe H, Morita M & Iguchi T 2003 Juvenile hormone agonists affect the occurrence of male Daphnia. Chemosphere 53 827–833.[Medline]
Thompson JD, Higgins DG & Gibson TJ 1994 CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22 4673–4680.
Wang YH, Wang G & LeBlanc GA 2007 Cloning and characterization of the retinoid X receptor from a primitive crustacean Daphnia magna. General and Comparative Endocrinology 150 309–318.[CrossRef][ISI][Medline]
Watanabe H, Tatarazako N, Oda S, Nishide H, Uchiyama I, Morita M & Iguchi T 2005 Analysis of expressed sequence tags of the water flea Daphnia magna. Genome 48 606–609.[Medline]
Yao TP, Segraves WA, Oro AE, McKeown M & Evans RM 1992 Drosophila ultraspiracle modulates ecdysone receptor function via heterodimer formation. Cell 71 63–72.[CrossRef][ISI][Medline]
Yao TP, Forman BM, Jiang Z, Cherbas L, Chen JD, McKeown M, Cherbas P & Evans RM 1993 Functional ecdysone receptor is the product of EcR and Ultraspiracle genes. Nature 366 476–479.[CrossRef][Medline]
Received in final form 25 January 2007
Accepted 26 January 2007
Made available online as an Accepted Preprint 2 February 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | CONTACT US | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
