|
|
||||||||
Immusol Inc., 10790 Roselle Street, San Diego, California 92121, USA
1 Department of Pathology, University of Ulm, Albert-Einstein-Allee 11, D-89081 Ulm, Germany
(Correspondence should be addressed to Q-X Li; Email: li{at}immusol.com)
| Abstract |
|---|
|
|
|---|
activity seems not required for the action of isoginkgetin, and isoginkgetin has only a slight effect on adipogenesis, which makes it an attractive candidate for anti-diabetic treatment. Further investigation revealed that both isoginkgetin and rosiglitazone activate AMP-activated protein kinase (AMPK) in adipocytes. Our findings suggest a novel mechanism for the elevation of adiponectin by isoginkgetin, which is different from that of rosiglitazone. Furthermore, this novel mechanism for adiponectin regulation involving AMPK can potentially facilitate new understanding of metabolic diseases and identification of new targets, as well as agents that increase plasma adiponectin levels. | Introduction |
|---|
|
|
|---|
(TNF
), and adiponectin (Mora & Pessin 2002). Adiponectin is a recently discovered protein of 30 kDa exclusively synthesized and secreted from adipocytes, which circulates at high levels (5–30 µg/ml; Arita et al. 1999). The concentration of adiponectin is inversely correlated to the body mass index, and the plasma levels of glucose, insulin, and triglyceride. Animal studies indicate that adiponectin has anti-diabetic and anti-atherogenic activities. Adiponectin knockout mice showed severe insulin resistance and diabetes (Maeda et al. 2002). Transgenic expression of globular domain of adiponectin ameliorated insulin resistance in ob/ob mice and reduced atherosclerosis in apoE-deficient mice (Yamauchi et al. 2003a). Administration of adiponectin in diet-induced obesity mice increased insulin sensitivity and reduced body weight (Fruebis et al. 2001, Shklyaev et al. 2003). In humans, insulin-resistant states such as obesity and type II diabetes are associated with lower levels of plasma adiponectin. Weight loss and therapy with thiazolidinediones, the drugs that enhance insulin sensitivity through stimulation of peroxisome proliferators-activated receptor-
(PPAR
), increase adiponectin levels (Combs et al. 2002). All these studies indicate that adiponectin might be an important therapeutic molecule for metabolic diseases. The site and mechanism of the putative anti-diabetic action of adiponectin are currently being investigated. Most studies have focused on liver and skeletal muscle cells where increased insulin sensitivity was observed upon adiponectin treatment. Adiponectin may also act on brain since intracerebro-ventricular injection of adiponectin reduced body weight in mice (Qi et al. 2004). The adiponectin actions are believed to be mediated by the two adiponectin receptors on the surface of the effector cells, adipoR1 and adipoR2, which are abundantly expressed in skeletal muscle and liver respectively (Yamauchi et al. 2003b). In skeletal myocytes, adiponectin activates 5'-AMP-activated protein kinase (AMPK), and thus stimulates fatty acid oxidation and glucose uptake (Yamauchi et al. 2002). In liver, adiponectin regulates molecules involved in gluconeogenesis (Yamauchi et al. 2002). The activation of the insulin receptor in skeletal muscle was also found to be regulated by adiponectin (Stefan et al. 2002).
So far, the regulation of adiponectin production is not fully understood. Several hormones or cytokines have been found to influence adiponectin levels. While insulin enhances adiponectin production by cells (Bogan & Lodish 1999), TNF-
and interleukin (IL)-6 suppress it (Fasshauer et al. 2003). ß-Adrenergic stimulation inhibits adiponectin gene expression, indicating a possible role of the adiponectin reduction in catecholamine-induced insulin resistance (Fasshauer et al. 2003). Rosiglitazone, a PPAR
agonist, ameliorates insulin resistance at least partially by elevating adiponectin level in vivo. However, rosiglitazone has side effects such as promoting adipogenesis, causing body weight gain and recently shown to increase cardiovascular risk. Therefore, a small molecule that enhances adiponectin production, but is not adipogenic, will be of important therapeutic value.
In this study, we screened a compound library for agents up-regulating adiponectin production, and identified isoginkgetin. Isoginkgetin is a natural compound isolated from the leaf extracts of Ginkgo biloba. It belongs to biflavones, which are composed of a large number of natural compounds and exhibit multiple biological activities including anti-oxidant, anti-inflammatory, and anti-tumor activities (Yoshikawa et al. 1999, DeFeudis et al. 2003). Ginkgetin, an isomer of isoginkgetin, has been showed to possess anti-inflammatory activities via the inhibition of cyclooxygenase (COX)-2 and 5-LOX (lipoxygenase) in vitro and inhibition of rat adjuvant-induced arthritis in vivo (Son et al. 2005). However, whether isoginkgetin has a potential anti-diabetic property has not been investigated. In human adipocyte LiSa cells and mouse adipocyte 3T3-L1 cells, isoginkgetin stimulates adiponectin secretion with potency comparable to that of rosiglitazone, but only weakly enhances adipogenesis. The mechanisms of isoginkgetin and rosiglitazone appear different for their distinct dependency on PPAR
activity and the kinetics of their actions. Our findings suggest a possible novel pathway for adiponectin up-regulation mediated by isoginkgetin. These in vitro results suggest the possibility of using isoginkgetin to improve insulin sensitivity via adiponectin up-regulation. Additional in-depth mechanism studies of isoginkgetin may shed light on the regulatory machinery of adiponectin secretion and provide novel strategies for developing adiponectin up-regulating compounds.
| Materials and Methods |
|---|
|
|
|---|
Isoginkgetin was purchased from Gaia Chemical Corp. (Gaylordsville, CT, USA). Rosiglitazone was purchased from Tocris (Ellisville, MO, USA). Cell culture reagents were obtained from Invitrogen. Adiponectin antibody was purchased from Affinity BioReagents (Golden, CO, USA). Phospho-AMPK antibody was purchased from Cell Signaling (Beverly, MA, USA). Compound C was obtained from Calbiochem (Darmstadt, Germany). All other reagents and chemicals were obtained from Sigma. Spectrum compound library was purchased from Microsource Discovery Systems Inc. (Gaylordsvile, CT, USA).
Cell cultures and differentiation
3T3-L1 mouse fibroblasts were purchased from ATCC (American Type Culture Collection, Manassas, VA, USA). The early passages of the cells were used in this study. The human adipocyte LiSa-2 cell line was generated and characterized by Dr Peter Moller (Wabitsch et al. 2000). Both 3T3-L1 cells and LiSa cells were maintained in Dulbeccos modified Eagles medium (DMEM) supplied with 10% fetal bovine serum in incubator with 5% CO2 at 37 °C. After the cells reached confluence, differentiation was induced by incubating cells in DMEM with 0.5 mM of 3-isobutyl-1-methylxanthine (IBMX), 1 µM dexamethasone, 1 µg/ml insulin, and 10% bovine growth serum. Isoginkgetin, rosiglitazone, or vehicle control DMSO was added either in differentiated LiSa cells or in 3T3-L1 cells, and incubated for indicated time. The conditioned medium was collected for further analysis.
ELISA measurement of adiponectin levels
Adiponectin concentration in conditioned medium was measured using DuoSet human adiponectin ELISA (R&D system, Minneapolis, MN, USA) and mouse adiponectin ELISA kit (B-Bridge International Inc., Sunnyvale, CA, USA) respectively.
Compound library screening
LiSa cells were cultured in 96-well plates. Differentiation was induced by adding 0.5 mM IBMX, 1 µM dexamethasone, and 1 µg/ml insulin to the culture medium. Three days post-differentiation, compounds from the library were added to the medium at a final concentration of 5 µM, and incubated for 4 days followed by ELISA measurements of adiponectin levels in the conditioned medium.
TaqMan real-time RT-PCR analysis
TaqMan real-time RT-PCR was performed as previously described (Ke et al. 2004). The dual-labeled fluorescent probe and PCR primer sequences for adiponectin-coding region are: probe: 5'FAM-CCCAACATGCCCATTC-GCTTTACCA-BHQ3'; forward primer: 5'GTGTGGGAT-TGGAGACTTACGTTAC3'; reverse primer: 5'TAGT-GGTTTTGCTGATTGTAGAAGATC3'. The sequences for ap2 gene are: probe: 5'FAM-TCATGAAAGGCGT-CACTTCCACGAGA-BHQ3'; forward primer: 5'AT-GATAAACTGGTGGTGGAATGC3'; reverse primer: 5'CGTCCCTTGGCTTATGCTCTC3'. Sequences for LPL gene are: probe: 5'-FAM-CATACATTCCTGTTA-CCGTCCAGCCAT-BHQ-3'; forward primer: 5'-CAG-CAAAACCTTCATGGTGAT-3'; reverse primer: 5'-CAAGTTTTGGCACCCAACTC-3'.
Western blot analysis
Cells were lysed in cell lysis buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 5 mM EDTA, 1% Triton X-100, 0.1% SDS, 1% deoxycholate, 1 mM NaF, 0.5 mM Na3VO3, 0.1 U/ml aprotinin, 10 U/ml leupeptin, 4 µg/ml pepstatin A). The lysates were centrifuged at 15 000 g for 10 min, and the supernatants were separated by SDS-PAGE. Proteins were transferred to nitrocellulose membrane. After blocking the membrane in PBS containing 5% nonfat milk (Bio-Rad Inc.), the proteins were blotted by indicated antibodies. After washing with PBS containing 0.1% Tween-20, the membrane was incubated with a horseradish peroxidase-conjugated secondary antibody. The blots were developed with the ECL kit (Amersham).
Oil-red O staining
The measurement of the lipid accumulation in 3T3-L1 cells was performed using Adipogenesis Assay Kit (Millipore, Billerica, MA, USA). Briefly, 3T3-L1 cells were cultured in 96-well plate. After differentiation and treatment with compounds, the cells were stained with oil red O solution. Quantitative results were obtained by adding dye extraction solution to the cells and measuring the absorbance from each well.
Lipolysis measurement
LiSa cells or 3T3-L1 cells were differentiated for 9 days, followed by incubating the cells in serum-free medium for 4 days. Compounds were then added to the cells and incubated for 6 h. Glycerol levels in the medium were measured according to the manufacturers instruction (Zen-Bio Inc., Research Triangle Park, NC, USA).
Human PPAR
-binding assay
The assay was performed as previously described (Adams et al. 2003). Briefly, Human PPAR
receptor was expressed as glutathione-s-transferase (GST) fusion proteins in Escherichia coli. After purification, the GST–PPAR
protein was used to establish a scintillation proximity assay-based receptor binding assay.
PPAR
–GAL4 chimeric transactivation assay
The assay was performed as previously described (Berger et al. 1999). Briefly, COS-1 cells were seeded in 96-well cell culture plates. After 24 h, pcDNA3–PPAR
–GAL4 (galactose inducible transcription factor 4) expression vector, pUAS(5X)-tk-luc reporter vector, and pCMV-lacZ as an internal control were transfected. The cells were then incubated for ~48 h in medium containing test compound. Cell lysates were produced and luciferase activity in cell extracts was determined.
Statistical analysis
The indicated data are presented as means±S.D. Statistical comparisons were performed between experimental groups and control group using Student t-test, with P<0.05 (*) designated as significant. All the data presented are based on triplicate experiments (n=3) unless otherwise stated.
| Results |
|---|
|
|
|---|
We were interested in identifying small molecules that up-regulate adiponectin production by adipocytes. We set up an adiponectin ELISA-based screen in 96-well plates to test a compound library composed of known drugs and natural products. A human liposarcoma cell line, LiSa, capable of differentiation under chemically defined culture conditions (Wabitsch et al. 2000) was used in the screening. After induction, LiSa cells express high levels of genes that are specific for differentiated adipocytes, such as PPAR
. The induced cells also functionally resemble differentiated adipocytes in response to insulin and lipolytic agents, rendering suitable as a human adipocyte model for drug screening. We first tested adiponectin production by LiSa cells after differentiation via measuring the secreted adiponectin in the culture medium using the ELISA. Several known PPAR
agonists in the library were among the hits identified during the screening, validating the screening strategy (Fig. 1
).
|
|
Although rosiglitazone is marketed as an insulin sensitizer, it causes weight gain due to its adipogenesis-enhancing property, rendering it undesirable. To determine whether isoginkgetin also promotes adipogenesis, oil-red O staining was used to measure lipid droplets accumulation in 3T3-L1 cells (Fig. 3A
). While rosiglitazone greatly potentiated adipogenesis, isoginkgetin only slightly induced lipid accumulation when compared with the vehicle control. Ap2, an adipocyte specific gene, has been used as a marker for adipogenesis since its expression increases upon differentiation. Taqman real-time RT-PCR analysis showed that ap2 expression was up-regulated by isoginkgetin treatment to much lesser levels than rosiglitazone treatment (Fig. 3B
). Another marker of adipogenesis, lipoprotein lipase (LPL), was also tested similarly by Taqman analysis, and no effect on LPL expression was observed by isoginkgetin treatment (data not shown). Therefore, the effects of isoginkgetin on adipogenesis are significantly less than those of rosiglitazone.
|
|
We further investigated the mechanism of action of isoginkgetin by comparing its effects with those of rosiglitazone. First, we examined the kinetics of adiponectin induction by the two compounds. Interestingly, while rosiglitazone increased adiponectin level as early as 24 h, reaching its maximal effect in 48 h, isoginkgetin acts with slower kinetics, sustaining the increase of extracellular adiponectin level during the course of 72 h (Fig. 5A
). This apparent distinction in the effect kinetics suggests potential different mechanisms of actions between these two compounds. Second, when we combined these two compounds in treatment, an additive effect on adiponectin production was observed (Fig. 5B
).
|
agonists elevate both adiponectin expression and secretion (Maeda et al. 2001). We were curious about how isoginkgetin promotes adiponectin production. Taqman real-time RT-PCR and western blot analysis were performed to measure adiponectin transcript and protein levels in LiSa cells (Fig. 6
|
agonist
Since it is known that PPAR
activation can increase adiponectin levels and our data suggest that isoginkgetin also up-regulates adiponectin production, we tested whether isoginkgetin is also a PPAR
agonist. Our data by human PPAR
-binding assay demonstrated that isoginkgetin binds to PPAR
with EC50 of 0.125 µM (Table 1
), approximately one half of the affinity of rosiglitazone binding to PPAR
(EC50 of 0.25 µM; Liu et al. 2005). In a chimeric hPPAR
–GAL4 transactivation assay in COS-1 cells, isoginkgetin weakly activated PPAR
with only 43% maximal activity at 10 µM (Table 1
), while rosiglitazone acted as a potent PPAR
agonist with EC50 of 0.02 µM (Liu et al. 2005). According to the data on these two experiments, isoginkgetin is a poor PPAR
agonist despite its ability to bind to PPAR
. Considering that isoginkgetin enhanced extracellular adiponectin production (EC50 of 0.1–0.5 µM) at concentrations much lower (20- to 100-folds less) than that required for PPAR
activation, it is unlikely that activation of PPAR
by isoginkgetin contributed significantly to the observed elevated adiponectin production.
|
agonist activity of isoginkgetin plays any role in its effect on adiponectin secretion. A PPAR
antagonist bisphenol A diglycidyl ether (BADGE) was used to treat LiSa cells. A volume of 500 µM BADGE blocked the effect of rosiglitazone on medium and intracellular adiponectin production, but did not inhibit the action of isoginkgetin, indicating that PPAR
activity is not required for the up-regulation of adiponectin by isoginkgetin (Fig. 7A and B
|
AMPK is one of the signaling molecules that were suggested to be involved in the anti-diabetic effect of rosiglitazone (Fryer et al. 2002a). In adipocytes, AMPK activity is crucial for fatty acid oxidation. To examine whether isoginkgetin also targets AMPK activity, the levels of phosphorylated AMPK at Thr 172 were assessed by western blot. AMPK activity appears to be significantly reduced upon cell differentiation (Fig. 8A
). Isoginkgetin and rosiglitazone both enhanced the phosphorylation of AMPK in differentiated LiSa cells compared with dimethyl sulphoxide (DMSO)-treated cells (Fig. 8A
). Thus, it seems one of the possible signaling molecules involved in isoginkgetin action is AMPK.
|
| Discussion |
|---|
|
|
|---|
agonists (Maeda et al. 2001, Combs et al. 2002). The PPAR
agonists, such as the drug Avandia (rosiglitazone), not only ameliorate insulin resistance but also cause weight gain which further increases the risk of type II diabetes and limits its application for diabetes. PPAR
agonists are also being investigated for this application due to their weight loss effect in rodents (Liu et al. 2005), but the potency of these agonists are generally lower than PPAR
agonists. In this study, we report a natural compound, isoginkgetin, up-regulating adiponectin production with potency comparable to that of rosiglitazone, but devoid of the potent adipogenesis-promoting effect of rosiglitazone. Isoginkgetin is one of the major active constituents in G. biloba extract, which has been used as an ancient Chinese remedy for its multiple biological activities, including anti-oxidant, anti-inflammatory, and anti-tumor activities (Yoshikawa et al. 1999, DeFeudis et al. 2003). The cellular signaling induced by this compound is largely unknown. This is the first study to reveal the potential insulin-sensitizing effects of isoginkgetin based on its regulation of adiponectin. Our observation of the effect of isoginkgetin on lipolysis is different from the results reported by DellAgli & Bosisio (2002). This could be due to the different experimental settings, such as incubation time. In addition, DellAgli observed a bi-phase effect of isoginkgetin on lipolysis, an enhancement of lipolysis was only observed at 0.03–0.3 µM isoginkgetin, and the abolishment of this effect is not explainable by cytotoxicity. Therefore, more detailed studies under different experimental conditions need to be carried out to address this distinction.
The mechanism of isoginkgetin action is apparently distinct from that of rosiglitazone for a number of reasons. First, inhibition of PPAR
activity did not affect the effect of isoginkgetin, whereas the activity of rosiglitazone was significantly diminished. Second, isoginkgetin and rosiglitazone exhibited differential stimulation kinetics. Third, results on the adiponectin mRNA and protein levels suggest the differential regulation of adiponectin synthesis and secretion by these two compounds. Fourth, although both compounds have comparable effects on adiponectin production, they have differential effects on adipogenesis and PPAR
activation.
Regulation of adiponectin production seems complex and has not been fully understood. Hormones and cytokines, including insulin, TNF-
, and interleukin-6, exhibited different effects on adiponectin production in vitro, while the signaling pathways mediating these regulations are largely unknown. The results that isoginkgetin potentiates adiponectin secretion in a likely PPAR
-independent manner suggest new types of targets and agents that can be explored for new therapy.
AMPK is a key regulator for energy metabolism in vivo. Activation of AMPK is involved in fat oxidation via the inhibition of downstream acetyl CoA carboxylase (ACC; Tomas et al. 2002). PPAR
agonists activate AMPK and inhibit ACC both in vitro and in vivo in skeletal muscle (Saha et al. 2004). Our data suggest that AMPK or genes upstream of the AMPK pathway maybe effectors of isoginkgetin action. Further experiments, for example introducing the kinase-dead AMPK into adipocytes to investigate its effect on isoginkgetin-regulated adiponectin production, would be helpful to confirm the involvement of AMPK. Whether isoginkgetin activates AMPK by increasing the ratio of AMP:ATP, as rosiglitazone does (Fryer et al. 2002a), needs to be further investigated. An interesting finding that inhibition of AMPK-reduced basal adiponectin production in differentiated adipocytes suggests the general role of AMPK in the regulation of adiponectin. Whatever the mechanism, the activation of AMPK and inhibition of phosphor-ACC by isoginkgetin will be beneficial for lipid regulation. Moreover, AMPK pathway can be further explored for adiponectin up-regulation.
In conclusion, isoginkgetin is a promising candidate compound for the treatment of insulin resistance based on our in vitro studies. Further in vivo studies are warranted. Analogs of isoginkgetin possessing higher potency in adiponectin production and lower PPAR
agonist activity can also be explored to identify more active compounds in vivo. Currently, insulin-sensitizing drugs mainly include PPAR
agonists and compounds that target the insulin signaling pathway. This study presents for the first time a potential new strategy for the discovery of insulin sensitizers by screening adiponectin production. Moreover, the critical genes involved in isoginkgetin action may provide novel targets for anti-diabetic therapy.
| Acknowledgements |
|---|
| Funding |
|---|
| References |
|---|
|
|
|---|
Arita Y, Kihara S, Ouchi N, Takahashi M, Maeda K, Miyagawa J, Hotta K, Shimomura I, Nakamura T, Miyaoka K et al. 1999 Paradoxical decrease of an adipose-specific protein, adiponectin, in obesity. Biochemical and Biophysical Research Communication 257 79–83.[CrossRef]
Berger J, Leibowitz MD, Doebber TW, Elbrecht A, Zhang B, Zhou G, Biswas C, Cullinan CA, Hayes NS, Li Y et al. 1999 Novel peroxisome proliferator-activated receptor (PPAR) gamma and PPARdelta ligands produce distinct biological effects. Journal of Biological Chemistry 274 6718–6725.
Bogan JS & Lodish HF 1999 Two compartments for insulin-stimulated exocytosis in 3T3-L1 adipocytes defined by endogenous ACRP30 and GLUT4. Journal of Cell Biology 146 609–620.
Combs TP, Wagner JA, Berger J, Doebber T, Wang WJ, Zhang BB, Tanen M, Berg AH, ORahilly S, Savage DB et al. 2002 Induction of adipocyte complement-related protein of 30 kilodaltons by PPARgamma agonists: a potential mechanism of insulin sensitization. Endocrinology 143 998–1007.
DeFeudis FV, Papadopoulos V & Drieu K 2003 Ginkgo biloba extracts and cancer: a research area in its infancy. Fundamental and Clinical Pharmacology 17 405–417.[CrossRef][ISI][Medline]
DellAgli M & Bosisio E 2002 Biflavones of Ginkgo biloba stimulate lipolysis in 3T3-L1 adipocytes. Planta Medica 68 76–79.[CrossRef][ISI][Medline]
Fasshauer M, Kralisch S, Klier M, Lossner U, Bluher M, Klein J & Paschke R 2003 Adiponectin gene expression and secretion is inhibited by interleukin-6 in 3T3-L1 adipocytes. Biochemical and Biophysical Research Communication 301 1045–1050.[CrossRef]
Fruebis J, Tsao TS, Javorschi S, Ebbets-Reed D, Erickson MR, Yen FT, Bihain BE & Lodish HF 2001 Proteolytic cleavage product of 30-kDa adipocyte complement-related protein increases fatty acid oxidation in muscle and causes weight loss in mice. PNAS 98 2005–2010.
Fryer LG, Parbu-Patel A & Carling D 2002a The Anti-diabetic drugs rosiglitazone and metformin stimulate AMP-activated protein kinase through distinct signaling pathways. Journal of Biolgical Chemistry 277 25226–25232.[CrossRef]
Fryer LG, Parbu-Patel A & Carling D 2002b Protein kinase inhibitors block the stimulation of the AMP-activated protein kinase by 5-amino-4-imidazolecarboxamide riboside. FEBS Letters 531 189–192.[CrossRef][ISI][Medline]
Inoki K, Zhu T & Guan KL 2003 TSC2 mediates cellular energy response to control cell growth and survival. Cell 115 577–590.[CrossRef][ISI][Medline]
Ke N, Albers A, Claassen G, Yu DH, Chatterton JE, Hu X, Meyhack B, Wong-Staal F & Li QX 2004 One-week 96-well soft agar growth assay for cancer target validation. Biotechniques 36 826–828, 830, 832–823.[ISI][Medline]
Lee M, Hwang JT, Lee HJ, Jung SN, Kang I, Chi SG, Kim SS & Ha J 2003 AMP-activated protein kinase activity is critical for hypoxia-inducible factor-1 transcriptional activity and its target gene expression under hypoxic conditions in DU145 cells. Journal of Biolgical Chemistry 278 39653–39661.[CrossRef]
Liu K, Xu L, Berger JP, Macnaul KL, Zhou G, Doebber TW, Forrest MJ, Moller DE & Jones AB 2005 Discovery of a novel series of peroxisome proliferator-activated receptor alpha/gamma dual agonists for the treatment of type 2 diabetes and dyslipidemia. Journal of Medicinal Chemistry 48 2262–2265.[CrossRef][ISI][Medline]
Maeda N, Takahashi M, Funahashi T, Kihara S, Nishizawa H, Kishida K, Nagaretani H, Matsuda M, Komuro R, Ouchi N et al. 2001 PPARgamma ligands increase expression and plasma concentrations of adiponectin, an adipose-derived protein. Diabetes 50 2094–2099.
Maeda N, Shimomura I, Kishida K, Nishizawa H, Matsuda M, Nagaretani H, Furuyama N, Kondo H, Takahashi M, Arita Y et al. 2002 Diet-induced insulin resistance in mice lacking adiponectin/ACRP30. Nature Medicine 8 731–737.[CrossRef][ISI][Medline]
Mayerson AB, Hundal RS, Dufour S, Lebon V, Befroy D, Cline GW, Enocksson S, Inzucchi SE, Shulman GI & Petersen KF 2002 The effects of rosiglitazone on insulin sensitivity, lipolysis, and hepatic and skeletal muscle triglyceride content in patients with type 2 diabetes. Diabetes 51 797–802.
McTernan PG, Harte AL, Anderson LA, Green A, Smith SA, Holder JC, Barnett AH, Eggo MC & Kumar S 2002 Insulin and rosiglitazone regulation of lipolysis and lipogenesis in human adipose tissue in vitro. Diabetes 51 1493–1498.
Mora S & Pessin JE 2002 An adipocentric view of signaling and intracellular trafficking. Diabetes Metabolism Research and Reviews 18 345–356.[CrossRef][ISI]
Qi Y, Takahashi N, Hileman SM, Patel HR, Berg AH, Pajvani UB, Scherer PE & Ahima RS 2004 Adiponectin acts in the brain to decrease body weight. Nature Medicine 10 524–529.[CrossRef][ISI][Medline]
Saha AK, Avilucea PR, Ye JM, Assifi MM, Kraegen EW & Ruderman NB 2004 Pioglitazone treatment activates AMP-activated protein kinase in rat liver and adipose tissue in vivo. Biochemical and Biophysical Research Communication 314 580–585.[CrossRef]
Shklyaev S, Aslanidi G, Tennant M, Prima V, Kohlbrenner E, Kroutov V, Campbell-Thompson M, Crawford J, Shek EW, Scarpace PJ et al. 2003 Sustained peripheral expression of transgene adiponectin offsets the development of diet-induced obesity in rats. PNAS 100 14217–14222.
Son JK, Son MJ, Lee E, Moon TC, Son KH, Kim CH, Kim HP, Kang SS & Chang HW 2005 Ginkgetin, a Biflavone from Ginko biloba leaves, inhibits cyclooxygenases-2 and 5-lipoxygenase in mouse bone marrow-derived mast cells. Biological and Pharmaceutical Bulletin 28 2181–2184.[CrossRef]
Stefan N, Vozarova B, Funahashi T, Matsuzawa Y, Weyer C, Lindsay RS, Youngren JF, Havel PJ, Pratley RE, Bogardus C et al. 2002 Plasma adiponectin concentration is associated with skeletal muscle insulin receptor tyrosine phosphorylation, and low plasma concentration precedes a decrease in whole-body insulin sensitivity in humans. Diabetes 51 1884–1888.
Tomas E, Tsao TS, Saha AK, Murrey HE, Zhang Cc C, Itani SI, Lodish HF & Ruderman NB 2002 Enhanced muscle fat oxidation and glucose transport by ACRP30 globular domain: acetyl-CoA carboxylase inhibition and AMP-activated protein kinase activation. PNAS 99 16309–16313.
Wabitsch M, Bruderlein S, Melzner I, Braun M, Mechtersheimer G & Moller P 2000 LiSa-2, a novel human liposarcoma cell line with a high capacity for terminal adipose differentiation. International Journal of Cancer 88 889–894.[CrossRef][ISI][Medline]
Wu X, Motoshima H, Mahadev K, Stalker TJ, Scalia R & Goldstein BJ 2003 Involvement of AMP-activated protein kinase in glucose uptake stimulated by the globular domain of adiponectin in primary rat adipocytes. Diabetes 52 1355–1363.
Yamauchi T, Kamon J, Minokoshi Y, Ito Y, Waki H, Uchida S, Yamashita S, Noda M, Kita S, Ueki K et al. 2002 Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase. Nature Medicine 8 1288–1295.[CrossRef][ISI][Medline]
Yamauchi T, Kamon J, Waki H, Imai Y, Shimozawa N, Hioki K, Uchida S, Ito Y, Takakuwa K, Matsui J et al. 2003a Globular adiponectin protected ob/ob mice from diabetes and ApoE-deficient mice from atherosclerosis. Journal of Biolgical Chemistry 278 2461–2468.[CrossRef]
Yamauchi T, Kamon J, Ito Y, Tsuchida A, Yokomizo T, Kita S, Sugiyama T, Miyagishi M, Hara K, Tsunoda M et al. 2003b Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Nature 423 762–769.[CrossRef][Medline]
Yoshikawa T, Naito Y & Kondo M 1999 Ginkgo biloba leaf extract: review of biological actions and clinical applications. Antioxidants and Redox Signaling 1 469–480.[Medline]
Zhou G, Myers R, Li Y, Chen Y, Shen X, Fenyk-Melody J, Wu M, Ventre J, Doebber T, Fujii N et al. 2001 Role of AMP-activated protein kinase in mechanism of metformin action. Journal of Clinical Invesigation 108 1167–1174.[CrossRef]
Received in final form 6 June 2007
Accepted 10 June 2007
Made available online as an Accepted Preprint 21 June 2007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | CONTACT US | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |